1. ¿Tienes un Mitsubishi ASX o lo vas a tener y aún no formas parte del Foro? ¡Pulsa aquí para registrarte y empezar a participar!
    Descartar aviso

ESTUDIO CONSUMO versión Gasolina

Tema en 'Mecánica' iniciado por urigrau, 16 Jul 2012.

  1. urigrau

    urigrau Nuevo Forero

    Ubicación:
    La Garriga-BCN
    Motor:
    160 MPI 117 CV
    Versión:
    Motion
    Color:
    Bronce Radiant
    Apreciados foreros, mi ASX tiene sólo un mes y todavía le estoy "tomando la medida".
    Acabo de repostar después del primer llenado de depósito y calculo que si hubiera vaciado por completo el depósito (hasta quedarme tirado) habría recorrido unos 850 quilómetros (circulé unos 20 o 30 en reserva de manera que sí apuré un poco el depósito aunque con prudencia pues no sé hasta qué punto es fiable el sensor que indica la diastancia que aún se puede recorrer).
    A ver, si el depósito tiene una capacidad de 63 l y he recorrido unos 850, eso implica un consumo medio de aprox 7,4 l no? Teniendo en cuenta que hasta el momento no ha rodado mucho el coche (850 km en un mes), que está en pleno rodaje y que algo más de la mitad de los 850 han sido autopista a 120/140, como lo veis? Es lo habitual?
    Como siempre gracias por todo ! :D
     
  2. pacguemon

    pacguemon Nuevo Forero

    Ubicación:
    Málaga
    Motor:
    160 MPI 117 CV
    Versión:
    Motion
    Color:
    Blanco Polar
    Depende de si apuras las marchas, o vas todo el tiempo dandole fuerte, gasta aún más, creo que has hecho un consumo bastante bueno, sobre todo teniendo en cuenta que son sus primeros kms.

    Saludos de otro gasolinero.
     
  3. picasssin

    picasssin Forero Honorífico

    Ubicación:
    Alora, Malaga y viviendo en Alhaurin de la torre
    Motor:
    160 MPI 117 CV
    Versión:
    Motion
    Color:
    Negro Amethyst
    estimado UNIGRAU
    tengo el mismo asx que el tuyo y lo tengo desde el 3 de enero, mi coche tiene 15500 km, y tengo apuntado en un librito que estrene para esa funcion, los kilometros, gasolineras, precios de combustibles, total y parcial de kilometros hechos etc, pues bien, el consumo que tengo es una media de 6.50, mitad autovia y mitad ciudad, con lo cual, teniendo en cuenta el volumen y peso de nuestro buga, es una pasada de poco consumo.
    un consejo, al principio, debes apurar las marchas, el motor te lo agradecera , debes hacerle caso al indicador de cambio de marchas.
    un saludo desde malaga
    picasssin


    PD.... se me olvidaba, si ves que te consume algo mas que al mio.... es por el color...:cool:
     
  4. Anayansi

    Anayansi Nuevo Forero

    Ubicación:
    Panamá
    Motor:
    160 MPI 117 CV
    Color:
    Plata Cool
    120/140?
    No se supone que un coche nuevo no se maneje por arriba de 100 hasta el primer cambio de aceite?
    Es eso acaso un "mito"?
    Igual yo me estoy conteniendo de no meterle el pie al acelerador.
     
  5. erpintaor

    erpintaor Forero Experto Socio

    Ubicación:
    Perdido en algun lado
    Motor:
    200 DI-D 150 CV
    Versión:
    Motion
    Color:
    Plata Cool
    anayansi, el primer cambio es a los 20000 en los gasolina.....
    creo que es mucho contener jejejeje, supongo que si subes progresivamente no habra problema a partir de los 5000km al menos eso hago yo, no se si sera asi, ya que de mecanica e informatica ando nivel principiante, pero me suena que mi coche ya a visto el tope antes de los 10000km
     
  6. VictorASX

    VictorASX Nuevo Forero Socio

    Ubicación:
    Barcelona
    Motor:
    180 DI-D 116 CV
    Versión:
    Motion
    Color:
    Blanco Polar
    jajaja chico malo..:p
     
  7. VictorASX

    VictorASX Nuevo Forero Socio

    Ubicación:
    Barcelona
    Motor:
    180 DI-D 116 CV
    Versión:
    Motion
    Color:
    Blanco Polar
    Hombre no esta mal el consumo para ser un gasolina y el coche que es.. si vas a 120 140 consume mas a mi a esas velocidas entre 6,0 y 6,5... pero yo soy diesel:cool:
    Mi consumo en estos 13200km que llevo desde el 9 de enero es 6,10 l/100 los tengo todos aqui: Details: Mitsubishi - ASX - 180 DI-D Motion - Spritmonitor.de por si quieres verlo jeje.

    Los primeros kilometos mas bien 2000km.. no hay que pasar de las 3mil vueltas y no darle mucha chicha.. despues ya a sacopaco si quiere uno jajaj madre mia el que aguante hasta el cambio de aceite sin pisarlo.. o tiene orchata en las venas o algo pasa jajaja!!
    (bueno puede que suba y no haga falta esperar al cambio jajajaja pero los gasolinos no fuman de ese problema)

    saludos y buena conduccion.
     
  8. pacguemon

    pacguemon Nuevo Forero

    Ubicación:
    Málaga
    Motor:
    160 MPI 117 CV
    Versión:
    Motion
    Color:
    Blanco Polar
    Yo solo he aguantado a bajas revoluciones hasta los 1500-2000 km, teniendo en cuenta que tengo ahora unos 6000 y que ya llevo con el ASX 10 meses......creo que mucho he aguantado....aunque como dice erpintaor...me suena que ya ha visto el tope...pero poco tiempo ehhhh.
    Saludos
     
  9. urigrau

    urigrau Nuevo Forero

    Ubicación:
    La Garriga-BCN
    Motor:
    160 MPI 117 CV
    Versión:
    Motion
    Color:
    Bronce Radiant
    Muchas gracias a todos por los comentarios.
    Seguiré estudiando el tema y haré caso a las sugerencias en cuanto a la contención a la hora de pisar el pedal (cuesta resistirse) y de cambiar las marchas.
    Saludos a todos.:)
     
  10. didac

    didac Nuevo Forero Socio

    Ubicación:
    Sant Joan Despi (BCN)
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    ,
    Victor he visitado tu spritmonitor,veo que has llegado a hacer 1.030 km con un deposito,es una pasada,yo ni soñarlo,mi consumo medio en 4900 km que llevo es de 7 litros la mayoria autopista y autovia a vel.media 130km.
    Veo que tienes repostajes superiores a 60 litros,cuantos caben en el deposito?, yo cuando se dispara la alarma de deposito bajo,reposto lo antes posible,no mefio del indicador de reserva.
    Felicidades por tu constancia en el control de gastos,yo siempre empiezo bien,luego ya es otra cosa.

    Saludos
     
  11. pollodesplumado

    pollodesplumado Forero Activo

    Yo conduzco como una ancianita, respetando siempre los límites de velocidad y sin apurar las marchas. Sólo le exijo en carreteras de montaña, que me encantan, donde me gusta ir ligerito y en pendientes fuertes hay que pisar sin contemplaciones. Los consumos globales, según el ordenador, están en torno a los 6 litrillos de gasofa. No sé si el japonés que lleva la cuenta es un pelín mentirosillo, pero la sensación que tengo es que el consumo es excepcionalmente bajo para el tamaño y peso del coche. Estoy encantado con eso, ahora bien, con el precio disparatado de la gasolina da lo mismo litro más litro menos: cualquier viaje, viajecillo o viajazo, sale siempre por una pastizarra. LLenar el depósito sale por un ojo de la cara y lo que más molesta: todo son impuestos. Al comprar el coche, tacataca; al repostar, tacataca y ahora con la subida del IVA, cada revisión, TACATACATACATACATACATÁ.
     
  12. CarlosMN

    CarlosMN Nuevo Forero

    Ubicación:
    Madrid
    Motor:
    160 MPI 117 CV
    Versión:
    Motion
    Color:
    Rojo Orient
    Actualmente eso es un mito pero no pasa nada por que no corras mucho, el motor tampoco se va a "amariconar" (otro mito).
     
  13. Franko

    Franko Nuevo Forero

    Motor:
    160 MPI 117 CV
    Versión:
    Motion
    Color:
    Blanco Polar
    Pues como comenté lo del ordenador de abordo es algo muy nuevo para nosotros y nos estamos haciendo a poder verlo,jajajajajaja me faltan ojos!... Toqueteando vimos que nos marcaba 8,7 todo el rato y bajo a 8,1.... ¿es normal? la conducción del primer día fue por ciudad y autovía, sin pasarnos de velocidad y utilizando siempre marchas largas.. LLenamos por completo el deposito, ya os diré cuantos kilómetros hemos hecho.
     
  14. Zoidberg

    Zoidberg Forero Experto Socio

    Ubicación:
    Madrid
    Motor:
    200 DI-D 150 CV
    Versión:
    Motion
    Color:
    Bronce Radiant
    Te aseguro que el de mi padre se amariconó, y el anterior también.
     
  15. Tonix

    Tonix Forero Experto

    Ubicación:
    En la costa marrón
    Motor:
    160 MPI 117 CV
    Color:
    Rojo Orient
    Es totalmente norrmal que oscile el consumo,hay una gran diferencia de circular por ciudad a carretera.
    Te doy un consejo,cambia al menú de kms parciales.....es mas relajante que estar viendo todo el rato los datos del consumo:cool:
     
  16. VictorASX

    VictorASX Nuevo Forero Socio

    Ubicación:
    Barcelona
    Motor:
    180 DI-D 116 CV
    Versión:
    Motion
    Color:
    Blanco Polar
    Yo ni lo miro, es un mentiroso jajaja... Para eso ya tengo: Details: Mitsubishi - ASX - 180 DI-D Motion - Spritmonitor.de actualizado y en 2 dias hace 1 año el coche desde que lo saqué del conce. (sí le he hecho muchos kms).
     
  17. sao

    sao Forero Activo Socio

    Ubicación:
    Madrid
    Motor:
    160 MPI 117 CV
    Versión:
    Motion
    Color:
    Blanco Polar
    Última edición: 11 Ene 2013
  18. Luisete

    Luisete Nuevo Forero

    Ubicación:
    Pamplona
    Motor:
    160 MPI 117 CV
    Versión:
    Challenge
    Color:
    Negro Amethyst
    Estimado forero. Llevo casi tres años con mi preciado ASX gasolina y aunque me encanta, te diré que es un poco gastón en ciudad y en autopista bastante. El no tener una sexta velocidad y que básicamente se cambia de marchas como en un diesel, hace que al llegar a 120 el consumo se dispare. Sabrás que en condiciones normales a 50 ya le puedes meter la quinta, pues este coche pide una sexta a partir de 100. Ya lo irás viendo. Por lo demás genial, no te arrepentirás.
     
  19. Tonix

    Tonix Forero Experto

    Ubicación:
    En la costa marrón
    Motor:
    160 MPI 117 CV
    Color:
    Rojo Orient
    Sexta a 100 ??????? Un gasolina atmosférico ??? Un motor japonés ??? eing ????
    Perdona pero difiero totalmente de tu opinión...pero éste es un foro libre para que cada usuario opine...
     
  20. jeopardize

    jeopardize Forero Experto Socio

    Ubicación:
    Anywhere
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Quinta a partir de 50???
    Con razón me consume mucho... ;)

    Saludos
     

Compartir esta página