1. ¿Tienes un Mitsubishi ASX o lo vas a tener y aún no formas parte del Foro? ¡Pulsa aquí para registrarte y empezar a participar!
    Descartar aviso

Metallube?

Tema en 'Mecánica' iniciado por doctaton, 12 Sep 2014.

  1. doctaton

    doctaton
    Moderador
    Miembro del equipo Socio

    Ubicación:
    Catalunya
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Buenos días a tod@s!!!

    Pues en estas vacaciones se me ha dado por (además de descansar) poner a tono mi moto y para ello, tal como venía haciendo en mis últimas 2 motos, decidí echarle Metallube.

    Qué es el Metallube?
    Pues según las especificaciones del producto, es un compuesto que ingresa en el poro del metal (levas, pistones, engranajes, etc, etc, etc) y reduce la fricción entre piezas de metal alrededor de un 95%, es decir, casi elimina por completo el desgaste entre partes. No confundir este producto con aditivos de aceite, ya que al ingresar y recubrir las superficies metálicas, NO SE VA CON EL CAMBIO DE ACEITE, sino que aseguran una protección de alrededor de 100.000 km.

    Cuando por primera vez descubrí este producto (de esto hace más de 3 años), desconfié inmediatamente, como si se tratara de un tónico crece-pelo. Sin embargo, la lectura de varios artículos, las opiniones de quienes lo han utilizado, y las pruebas de desguace de motores tratados con este producto, me han echo cambiar de opinión y utilizarlo.

    Mi primera moto con este producto, era una Africa Twin, en impecables condiciones, pero con 20000 km en sus espaldas, por lo que decidí probarlo.

    Lo bueno que tienen las motos, es que al estar el motor prácticamente pegado al cuerpo del motorista, todo lo que le hagamos a la mecánica, tiene repercusión directa por el conductor que se da cuenta en el acto, de cualquier cambio que tenga el motor, ya sean ruidos, cambios de temperatura, suavidad, etc.

    Aún recuerdo mi primera impresión tras echarle el Metallube. Dije... guuuuuuaaaaaauuuuuuu! :eek:

    Los ruidos de embrague y engranaje de marchas desaparecieron al instante, el motor ganó una suavidad nunca antes vista, los cambios (siempre muy sensibles en las motos) entraban como la seda y... fundamentalmente la temperatura disminuyó muchísimo.

    La verdad es que me quedé perplejo por todos estos cambios, pero la prueba final que esto funciona es en el cambio de aceite.

    Cuando cambiamos aceite, éste sale marrón oscuro, casi negro. Pues bien, luego de rodar 5000 km con el Metallube, el aceite que salió del cárter de mi Africa, estaba como el primer día! Impresionante.

    Esto puede significar sólo una cosa: que la fricción entre piezas había, sino desaparecido, disminuido muchísimo.

    Luego de este experimento, le agregué Metallube a mi otra moto, una Triumph Tiger XC. Como esta moto la compré nueva, no he tenido la oportunidad de decir si le ha servido o no, por el simple hecho que se lo agregué al finalizar el rodaje (no agregar a vehículos nuevos porque como disminuye la fricción, el rodaje no se hace correctamente) y la moto si bien mejoró muchísimo, éstas siempre mejoran luego del primer cambio de aceite.

    Ahora, yendo a comprar unos chiclés de carburador para recarburar mi nueva joya (una hermosa Speedmaster carburada con sólo 3000 km que os la presento a continuación) he visto el Metallube y he decidido ponérselo.

    Mi moto, no hacía ruido (claro, es un motor que casi ni se ha rodado), pero los cambios entraban duros, bruscos y muy ruidosos, propios del carácter de la moto. Por supuesto, al agregar el dichoso Metallube, la moto va como una seda y los cambios son otros, entrando suaves y sin ruidos.

    Os recuerdo, que no se trata de un aditivo de aceite. Éstos aumentan la viscosidad del aceite, lo que hace que se disimulen los ruidos y se consuma menos aceite porque el paso del cárter a la cámara de combustión se reduce mucho al ser el aceite más viscoso. Esto es un concepto totalmente diferente.

    A qué viene todo esto?

    Pues simple. Nuestro aceite, al estar sometido a las condiciones pésimas de mezcla con gasoil que todos sabemos, pierde potencial de lubricación con el tiempo. Esto, ha provocado en algunos modelos, averías conocidas por todos, tanto en la camisa de los cilindros, como en los turbos. Estas roturas, pese a no estar aceptadas por Mitsubishi como parte del problema de lubricación (o falta de ella), parecen estar de alguna manera relacionadas con el aceite.

    La semana pasada, he hecho la revisión de los 60000 km (como siempre, atención perfecta en MMCE Granollers) y el aceite, estaba en su límite máximo, pero lo que más me preocupó, eran sus características: negro carbón y con una viscosidad que no era la que le tocaba, seguramente producto de las diluciones permanentes con gasoil.

    Y allí se me ocurrió...

    Si el aceite pierde sus características con el tiempo... qué mejor que proteger las piezas metálicas lubricadas, con Metallube, que le forma una capa que evita el desgaste y la fricción?

    Aquí dejo el tema para que lo discutamos y ver qué os parece. Os recuerdo, que no se trata de un aditivo, sino un compuesto que se "mete" dentro del metal y lo protege de la fricción. Os recomiendo que leáis del tema, ya que puede ser muy interesante.

    Recordar además que NO debe echarse a los motores en fase de rodaje. Una vez finalizado éste, si se le agrega Metallube, prácticamente se detendría el desgaste por fricción (o eso aseguran los expertos). Se habla de motores "congelados" en lo que se refiere a desgaste.

    Por mi parte, me pongo a leer un poco más acerca de este producto en motores diesel, ya que mi experiencia, es solo en motores de motos, pero por lo visto hasta ahora, todo son efectos positivos.

    A menos que alguien aporte algún dato que vaya en contra de esto, yo se lo agregaré. Si os parece y hay quorum, organizamos una compra conjunta.

    De más está decir, que no voy a comisión, malpensados!!! :p

    Aquí lo prometido... la luz de mis ojos:



    [​IMG]
     
    A rigelvega y nieves les gusta esto.
  2. goose

    goose Forero Experto Socio

    Ubicación:
    Madrid, Salamanca o Albacete, depende del dia
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Mira que yo soy reacio a poner este tipo de aditivos (por lo que dices tu del crecepelo), pero he de reconocer que mal no hace (al contrario de otros que llega a obturar conductos), se lo puse al alfa y notar no note nada, en un coche es mas difícil notar ciertas cosas, y se lo puse solo al motor, no al cambio, pero mal como he dicho no le hizo, y de esto hace mas de 70k km.

    Sera cuestión de probar, sobre todo a los que les sube el aceite y por ende para proteger el turbo.

    Eso si, seguid al pie de la letra el modo de uso que dice el fabricante.

    En una compra conjunta si podría estar interesado.

    PD: Bonita burra
     
  3. Zoidberg

    Zoidberg Forero Experto Socio

    Ubicación:
    Madrid
    Motor:
    200 DI-D 150 CV
    Versión:
    Motion
    Color:
    Bronce Radiant
    Yo estuve muy interesado hace un año exactamente, de hecho lo probé.
    A posteriori leí la controversia creada en el mismo foro de Metallube por un proveedor de aditivos (Josías) que lo incluyó durante un tiempo en su catálogo y tras enviarlo a analizar descubrió que contenía fósforo en una cantidad escandalosa, que para circuitos cerrados y coches antiguos puede venir bien (junto con sus componentes "secretos") pero mortal para los DPF que gastamos.

    http://comunidad.metallube.es/no-co...J7Vr01k-7u5ocQGW3bzpkqS3xucyJ4O5AO2PvgOL7cRq3

    Fue el único que puso datos sobre la mesa, mientras que los de Metal Lube se diluían en argumentos de pocimero de los 80.

    Así que mucho ojo con los ungüentos de la abuela, que pueden traer sorpresa.

    Yo afortunadamente lo eché poco antes del cambio de aceite (aunque sea tan milagroso que permanezca 100.000 Km), puedo decir que es verdad que los 1000 primeros Km el coche sonaba más redondo, pero se pasa rápido.
    Lo de que se "mete" en el metal, si lo hablas con entendidos te dirán que para qué está entonces el bruñido de los pistones y los cilindros. La verdad es que con la cabeza fría, todo suena a lo que comenta Doc del crecepelo. Ciertamente, consiguen efectos, pero a base de qué. Sólo a la larga se podría saber, pero imagino que nadie quiere sorpresas.

    Del que me he informado también es de la gama Xenum (con sello TÜV y que vende Josías), y tiene mejor pinta, pero cuestan su dinerito.
    Unos dirán ¿crítica interesada?, podría ser, pero qué más le da a este señor vender una cosa o la otra, simplemente se interesó por lo que vendía no fuese a traerle más problemas que beneficios.

    No es una opinión a la buena de Dios, he estado un año entero siguiendo el tema de los antifricción.
     
    Última edición: 12 Sep 2014
  4. Bluetank

    Bluetank Forero Activo

    Ubicación:
    Madrid
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Desde mi punto de vista, este hilo puede servir para saber sobre todo que antifricción ponerle a nuestro bicho, más que ponerle o no ponerle. Yo estaría interesado en la compra conjunta del que resulte mejor parado.

    Saludetes.
     
  5. Zoidberg

    Zoidberg Forero Experto Socio

    Ubicación:
    Madrid
    Motor:
    200 DI-D 150 CV
    Versión:
    Motion
    Color:
    Bronce Radiant
    Yo también me apunto, es un tema que agradezco a Doc que saque a la palestra de este foro nuestro, que seguro que con la plantilla que tenemos, salen opiniones suficientes como para tener una conclusión bien conformada.
     
  6. Bluetank

    Bluetank Forero Activo

    Ubicación:
    Madrid
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Yo, por ahora voto al de la certificación Tüv: los alemanes son muy suyos con los coches y no echarían nada que los pueda estropear ;-)
     
  7. goose

    goose Forero Experto Socio

    Ubicación:
    Madrid, Salamanca o Albacete, depende del dia
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Fiate de los alemanes y no corras.

    Zoid desconocia lo del metallube, en el laboratorio cuando empezaron a salir este tipo de productos recuerdo que se analizaron algunos, todos iban basicamente con la misma base, creo recordar (no me hagais mucho caso....lo mirare) que un acceite SAE 50 y una serie de aditivos que no solo no valian para nada practicamente si no que en algunos casos eran perjudiciales, como algunos de los que llevaban teflon que terminaban por obturar circuitos, cuando vuelva el lunes si tengo un ratillo lo miro
     
  8. Bluetank

    Bluetank Forero Activo

    Ubicación:
    Madrid
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Hombre Goose, donde trabajo, estoy rodeado de mecánicos, y no me han dicho nada malo... para motores sin FAP. Para motores con FAP no tienen información, así que, como bien dices, todo es buscar a ver que sale.
    Y me fio bastante de los alemanes... tanto que tengo un coche japones ;)
    Pasé una temporada viviendo allí, y ves que las cosas se hacen de otra manera. Si un producto daña el motor y no lo avisa (Por ejemplo el caso de nuestros FAP) el que lo vende va a la cárcel sin pasar por la casilla de salida. Así que ¡A buscar a ver si son recomendados en nuestros motores!

    Saludetes.
     
  9. doctaton

    doctaton
    Moderador
    Miembro del equipo Socio

    Ubicación:
    Catalunya
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Excelente el debate generado en el Foro de Metallube respecto al contenido de P (fósforo) del producto, gracias @Zoidberg por el enlace! La verdad que este tema de "antifricción", llamémoslo así, es interesantísimo. La respuesta de Metallube (en realidad responde un comercial con el libreto aprendido) a los planteamientos del tal Josías, es de traca...

    En motores sin FAP, no me caben dudas que el Metallube es excelente, aunque dudo mucho de su eficacia (cada 100000 km) ya que ésta parece más un arma de marketing que la realidad.

    Sin embargo, se ha puesto muy de moda el tema del contenido de P y su relación con el FAP (o DPF).

    En teoría, el contenido de P del Metallube es alto y este elemento es nocivo para el DPF, pero es llamativo que hasta donde he podido ver, no hay reportados muchos DPF's tapados por su culpa...

    Lo cierto, es que sea Metallube o os producto de TÜV, añadir al aceite alguno de estos productos parece ser una buena alternativa para nuestros coches.
     
  10. Zoidberg

    Zoidberg Forero Experto Socio

    Ubicación:
    Madrid
    Motor:
    200 DI-D 150 CV
    Versión:
    Motion
    Color:
    Bronce Radiant
    Yo cuando ví la demostración de la máquina de presión con los cilindros, añadiendo arena al aceite etc etc... quedé sorprendidísimo (como cuando ves magia) pero detrás de toda magia siempre hay truco. Si no lo es, pues que no vengan con pseudo-ciencias, y si es tan bueno y milagroso, papeles sobre la mesa. Todo este mundillo se basa únicamente en experiencia de unos y de otros, pero es como con las Power Balance, he conocido gente que habrían saltado desde la terraza del quinto para demostrarme que poco menos que les hacía inmortales.
    A mí me es indiferente si lo dicen los del TÜV o los de laboratorios Pepito, pero con datos concluyentes sobre las cosas que se afirman. Siempre están los que comentan "mal no le va a hacer", pero claro, si no le hace mal y los beneficios son únicamente sensaciones subjetivas... estoy pagando placebos y "no baratos" que digamos.
    Por eso de momento cogeré con pinzas a unos y a otros, aunque esté "demostrado" que los antifricción basados en cerámica son buenos para motor (queda caro que para piezas móviles lo son).
    Al menos sí tienen en catálogo un aceite 100% esteres sintéticos, si luego se les quiere añadir aditivos es algo más personal.
    Y que conste que lo dice uno que sopesa el añadirle el VX500 en éste su último cambio en garantía.

    Aquí dejo una réplica al vídeo de la máquina de presión con ML
    https://www.youtube.com/watch?v=PSWGCYBJKIc
     
  11. Zoidberg

    Zoidberg Forero Experto Socio

    Ubicación:
    Madrid
    Motor:
    200 DI-D 150 CV
    Versión:
    Motion
    Color:
    Bronce Radiant
    Así que se trata de ésta...
    Ésta es ella... ¿verdad?
     
  12. elobey

    elobey Forero Experto Socio

    Ubicación:
    Sevilla y Cádiz
    Motor:
    160 MPI 117 CV
    Versión:
    Challenge
    Color:
    Blanco Polar
    Yo he utilizado siempre Bardahl en las motos y tanbien lo utilicé en los dos ultimos coches diesel que he tenido, uno atmoferico y otro turbo, en este último en el concesionario se extrañaron de la compresión que seguia teniendo despues de 250 mil km y utilizaba aceite mineral en todos ellos, nunca tuve problemas, ahora me tengo que enterar si es o no es recomendable en coches con catalizador, como ya se ha comentado, hay que utilizarlo una vez realizado el rodaje y en teoria no hay que repetir la operación hasta los 100.000 km siguientes


    http://bardahl.com/es/
     
  13. doctaton

    doctaton
    Moderador
    Miembro del equipo Socio

    Ubicación:
    Catalunya
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar

    Yo creo que se confunden conceptos, @elobey.

    Una cosa son los aditivos del aceite que todos conocemos, como el caso del Bardahl que comentas y, otra muy distinta, los productos antifricción como el Metallube o similares.

    Los primeros, son aditivos del aceite porque modifican las propiedades del mismo, básicamente lo hacen más denso por decirlo de alguna manera.

    Pongamos un ejemplo: si metemos un aceite por ejemplo 5W40 y le agregamos un aditivo, ese aceite deja de ser 5W40 para pasar a tener otras propiedades diferentes. La consecuencia directa de esto, es que el aceite más denso, tapona los sitios que han ido cogiendo holguras secundarias al desgaste propio del roce entre piezas metálicas (interfaz camisa-pistones, bielas, tapa de balancines, asientos de válvulas, etc.), y por donde se producen fugas de aceite que pasa directamente del cárter a la cámara de combustión o, en casos más llamativos, del cárter al suelo de tu parking. Los aditivos, al aumentar la densidad del aceite, además enmascaran los ruidos del motor, ya que disminuye mucho el roce de sus partes metálicas, interponiendo entre ellas más aceite y además más denso. El resultado a corto plazo, es un aumento de la compresión y mejora (siempre transitoria) del motor, sacrificando el desgaste que se produce en los arranques en frío ya que al ser un aceite mucho más denso, hasta que no se calienta, le cuesta llegar a las partes altas del motor. Vamos, poco más que un maquillaje transitorio, destinado a prolongar algo más motores casi reventados o, por el contrario, reducir el consumo o pérdida de aceite y disimular ruidos en coches que se quieren revender. Esto se hizo desde hace muchos años con revendedores de coches de segunda mano, que agregaban aceite de caja de cambios al cárter, (por ejemplo Valvulina, mucho más denso) para tapar todas las fugas y ruidos.

    El caso del Metallube y demás compuestos antifricción, es muy diferente. Estos productos, si bien se echan al aceite, no modifican las propiedades del mismo (viscosidad, punto de ebullición, características físicas, etc.). Es decir, en el caso del ejemplo anterior, un aceite 5W40 tratado con estos productos, SIGUE siendo un aceite 5W40.

    Entonces cómo actúan los productos antifricción?
    Pues se adhieren al metal (algunos, como Metallube, sostienen sostienen que penetran en sus poros), gracias a elementos inertes (salvo en vehículos como el nuestro que tienen FAP o DPF) fundamentalmente fósforo y antimonio, que, combinados, forman una película que no se va con los cambios del aceite y disminuye casi a 0, el desgaste por fricción y la pérdida de potencia, con descenso drástico de la temperatura de piezas en constante movimiento, como los pistones con los cilindros, bielas con cigüeñal o engranajes de la caja de cambio.

    El concepto es diferente. Mientras los aditivos aumentan la densidad del aceite y mejoran la compresión y taponan las fugas, los productos antifricción, evitan el roce acero contra acero interponiendo una película protectora entre ambas superficies, frenando así el desgaste por fricción y la pérdida de potencia producida en la generación de calor.

    Por lo tanto, el mejor momento de echar los productos antifricción (a diferencia de los aditivos) es precisamente ANTES que se haya producido el desgaste, para prevenir el mismo.

    Una vez que lo pruebas, ves la suavidad con la que va la moto y entran sus cambios y además ves como sale el aceite claro luego de 6000 km, te das cuenta que evidentemente algo hacen. En coches, no los he probado aún y lo único que me detiene es el tema del fósforo y como actúa en el DPF, aunque tengo claro que si tuviera un gasolina, o un diésel sin DPF, se lo echo sin pensármelo 2 veces.

    Repito que no vendo estos productos ni tengo el menor interés que alguien los compre. ;)
     
    Última edición: 13 Sep 2014
  14. jsl230

    jsl230 Forero Habitual Socio

    Ubicación:
    Miguelturra
    Motor:
    200 DI-D 150 CV
    Versión:
    Motion 4WD
    Color:
    Blanco Polar
    Doc, ya me has liado, no me atrevido con el tratamiento del aceite por lo que comentas, pero he comprado el de combustible diésel. Lo pondré una temporada a ver sí noto alguna diferencia.
     
  15. doctaton

    doctaton
    Moderador
    Miembro del equipo Socio

    Ubicación:
    Catalunya
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Jeje a mi no me metas que no he hablado de aditivos de combustible :D
     
  16. elobey

    elobey Forero Experto Socio

    Ubicación:
    Sevilla y Cádiz
    Motor:
    160 MPI 117 CV
    Versión:
    Challenge
    Color:
    Blanco Polar
    No veo la diferencia con el Bardahl B-1 Oil Supplement, tambien es un aditivo antifriccion, para motores con perdidas de compresion y desgaste tienen el. B-2 Oil Treatment, este ultimo no lo he utilizado. EL primero es un aditivo ( el Metal lube tambien) que al incorporarse al aceite forma una pelicula protectora que suaviza la fricción y minimiza el desgaste, aparte otras ventajas derivadas de esta menor fricción. No se si es mejor o peor uno u otro, pero es el que yo he utilizado y me ha dado un buen resultado en cuanto a prevencion de desgaste, o por lo menos eso creo, alomejor si no le hubiese puesto nada me lo habria dado igual.
     
  17. elobey

    elobey Forero Experto Socio

    Ubicación:
    Sevilla y Cádiz
    Motor:
    160 MPI 117 CV
    Versión:
    Challenge
    Color:
    Blanco Polar
    Otro parecido es el Muscle MT 10 o Super Kote 2000, igualmente aditivos antifriccion para el aceite. Aclaro: Cuando digo que son aditivos, es porque son productos que SE AÑADEN, aunque la funcion que desempeñan sea diferente al del añadido
     
  18. goose

    goose Forero Experto Socio

    Ubicación:
    Madrid, Salamanca o Albacete, depende del dia
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    A mi se me ocurre una pregunta....asi a bote pronto...., si este tipo de productos funcionan de verdad...¿como es que los fabricantes no los usan?, el gasto para ellos seria minimo y los beneficios grandes, dado que las garantias cada vez duran mas, si durante ella las intervenciones en los motores es menor es dinero para ellos, por no hablar de la publicidad de motores mas duraderos y sobretodo con menos consumo, e incluso meterlo como mantenimiento periodico como puede ser cualquier otra cosa.
     
  19. elobey

    elobey Forero Experto Socio

    Ubicación:
    Sevilla y Cádiz
    Motor:
    160 MPI 117 CV
    Versión:
    Challenge
    Color:
    Blanco Polar
  20. doctaton

    doctaton
    Moderador
    Miembro del equipo Socio

    Ubicación:
    Catalunya
    Motor:
    200 DI-D 150 CV
    Versión:
    Kaiteki 4WD
    Color:
    Blanco Polar
    Según he leído, el Super Kote 2000 y el Muscle MT 10, actuarían parecidos al Metallube, es decir, tratan el metal y no el aceite, no modificando sus características.

    El Bardahl B-1 Oil Supplement, parece ser más un aditivo de toda la vida, es decir, trata el aceite más que el metal, modificando sus características intrínsecas y favoreciendo su adherencia a las partes metálicas.

    La gran diferencia, desde mi punto de vista, es que los primeros actúan en el metal, mientras que los aditivos actúan sobre el aceite.

    El resultado final, parece ser el mismo, es decir, disminuir la fricción entre superficies metálicas, pero me parece más inocuo el tratamiento del metal, que la modificación de las propiedades del lubricante.
     

Compartir esta página